Complete DNA sequence coding for the large ribosomal RNA of yeast mitochondria.

نویسندگان

  • F Sor
  • H Fukuhara
چکیده

The mitochondrial gene coding for the large ribosomal RNA (21S) has been isolated from a rho- clone of Saccharomyces cerevisiae. A DNA segment of about 5500 base pairs has been sequenced which included the totality of the sequence coding for the mature ribosomal RNA and the intron. The mature RNA sequence corresponds to a length of 3273 nucleotides. Despite the very low guanine-cytosine content (20.5%), many stretches of sequence are homologous to the corresponding Escherichia coli 23S ribosomal RNA. The sequence can be folded into a secondary structure according to the general models for prokaryotic and eukaryotic large ribosomal RNAs. Like the E.coli gene, the mitochondrial gene contains the sequences that look like the eukaryotic 5.8S and the chloroplastic 4.5S ribosomal RNAs. The 5' and 3' end regions show a complementarity over fourteen nucleotides.

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

A comparative phylogenetic analysis of Theileria spp. by using two two "18S ribosomal RNA" and "Theileria annulata merozoite surface antigen" gene sequences

More than 185 species, strains and unclassified Theileria parasites are categorized in the Entrez Taxonomy. The accurate diagnosis and proper identification of the causative agents are important for understanding the epidemiology, prevention and appropriate treatment. This study aims to discuss the importance of two genes of Theileria annulata 18S ribosomal RNA (18S rRNA) and Theileria annulata...

متن کامل

Nature of an inserted sequence in the mitochondrial gene coding for the 15S ribosomal RNA of yeast.

The small ribosomal RNA, or 15S RNA, or yeast mitochondria is coded by a mitochondrial gene. In the central part of the gene, there is a guanine-cytosine (GC) rich sequence of 40 base-pairs, flanked by adenine-thymine sequences. The GC-rich sequence is (5') TAGTTCCGGGGCCCGGCCACGGAGCCGAACCCGAAAGGAG (3'). We have found that this sequence is absent in the 15S rRNA gene of some strains of yeast. Wh...

متن کامل

Comparative bioinformatics analysis of a wild diploid Gossypium with two cultivated allotetraploid species

Background: Gossypium thurberi is a wild diploid species that has been used to improve cultivated allotetraploid cotton. G. thurberi belongs to D genome, which is an important wild bio-source for the cotton breeding and genetic research. To a certain degree, chloroplast DNA sequence information are a versatile tool for species identification and phylogenetic implications in plants. Different ch...

متن کامل

Initiation of transcription in yeast mitochondria: analysis of origins of replication and of genes coding for a messenger RNA and a transfer RNA.

The initiation of transcription of the yeast mitochondrial genes coding for subunit I of cytochrome c oxidase (COX1) and for tRNA1Thr has been examined. COX1 messenger RNA synthesis is initiated in a conserved nonanucleotide sequence (ATATAAGTA) which we have previously found immediately upstream of ribosomal RNA genes at positions at which RNA synthesis starts. The 5'-end of the precursor of t...

متن کامل

The male and female complete mitochondrial genome sequences of the Endangered freshwater mussel Potomida littoralis (Cuvier, 1798) (Bivalvia: Unionidae).

Freshwater mussels of the family Unionidae exhibit a particular form of mitochondria inheritance called double uniparental inheritance (DUI), in which the mitochondria are inherited by both male and female parents. The (M)ale and (F)emale mitogenomes are highly divergent within species. In the present study, we determine and describe the complete M and F mitogenomes of the Endangered freshwater...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

عنوان ژورنال:
  • Nucleic acids research

دوره 11 2  شماره 

صفحات  -

تاریخ انتشار 1983